ID: 1024980559_1024980569

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1024980559 1024980569
Species Human (GRCh38) Human (GRCh38)
Location 7:55154291-55154313 7:55154320-55154342
Sequence CCGTCCAGGCACACAGGCGAGGG CTGGCTTGCTACCGAGGAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 216} {0: 1, 1: 1, 2: 0, 3: 4, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!