ID: 1025012172_1025012183

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1025012172 1025012183
Species Human (GRCh38) Human (GRCh38)
Location 7:55406329-55406351 7:55406380-55406402
Sequence CCCTGGTGCCTTCTCAGGAACAA CAGAAGATGGGGGAGCAGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 195} {0: 1, 1: 0, 2: 1, 3: 26, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!