ID: 1025061526_1025061531

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1025061526 1025061531
Species Human (GRCh38) Human (GRCh38)
Location 7:55812800-55812822 7:55812824-55812846
Sequence CCCCAGCAGCACCATACTAAACA AGAGAGAATCTGTGTGTTTTGGG
Strand - +
Off-target summary No data {0: 3, 1: 4, 2: 78, 3: 191, 4: 765}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!