ID: 1025061528_1025061531

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1025061528 1025061531
Species Human (GRCh38) Human (GRCh38)
Location 7:55812802-55812824 7:55812824-55812846
Sequence CCAGCAGCACCATACTAAACAGA AGAGAGAATCTGTGTGTTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 114} {0: 3, 1: 4, 2: 78, 3: 191, 4: 765}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!