ID: 1025069676_1025069686

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1025069676 1025069686
Species Human (GRCh38) Human (GRCh38)
Location 7:55887590-55887612 7:55887612-55887634
Sequence CCGGGTCCACCGCGGCGGCGGCG GGCGGCGGCGGCGGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 274} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!