ID: 1025078068_1025078075

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1025078068 1025078075
Species Human (GRCh38) Human (GRCh38)
Location 7:55960418-55960440 7:55960467-55960489
Sequence CCTAGCATATGGTGACACATGTG CCGTCTCTAAAATATTTTAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 22, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!