ID: 1025115511_1025115515

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1025115511 1025115515
Species Human (GRCh38) Human (GRCh38)
Location 7:56254763-56254785 7:56254780-56254802
Sequence CCGTCCTCCTTCTGTTCATAAGT ATAAGTGGTGCTTGTGCATCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 18, 4: 291} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!