ID: 1025709784_1025709793

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1025709784 1025709793
Species Human (GRCh38) Human (GRCh38)
Location 7:63898699-63898721 7:63898744-63898766
Sequence CCGCCCAAGTTTTATACCCAACA ATACAAATAAAACCCTACCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 17, 3: 53, 4: 343}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!