ID: 1025927241_1025927247

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1025927241 1025927247
Species Human (GRCh38) Human (GRCh38)
Location 7:65969994-65970016 7:65970011-65970033
Sequence CCAAAGACCATCTGTGAAAACAG AAACAGACTGGCTGCGGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 17, 2: 2, 3: 25, 4: 267} {0: 2, 1: 0, 2: 0, 3: 5, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!