ID: 1026077830_1026077834

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1026077830 1026077834
Species Human (GRCh38) Human (GRCh38)
Location 7:67189099-67189121 7:67189128-67189150
Sequence CCTTCCTTTTTCTATCTACCCTG GTTTCTCTTTTGTGAGTCAAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 5, 3: 43, 4: 545} {0: 2, 1: 0, 2: 4, 3: 18, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!