ID: 1026088394_1026088402

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1026088394 1026088402
Species Human (GRCh38) Human (GRCh38)
Location 7:67280907-67280929 7:67280955-67280977
Sequence CCCTGTCTCTTCTAGAAGCACAA ACCTGTAATCCCAGCTACTTGGG
Strand - +
Off-target summary {0: 8, 1: 0, 2: 152, 3: 5593, 4: 80206} {0: 15366, 1: 98640, 2: 233329, 3: 337639, 4: 469862}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!