ID: 1026343418_1026343424

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1026343418 1026343424
Species Human (GRCh38) Human (GRCh38)
Location 7:69453549-69453571 7:69453576-69453598
Sequence CCAGTTAAACATACACATTCCCA TTTCTTCTGGGATGATGACCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!