ID: 1026395325_1026395332

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1026395325 1026395332
Species Human (GRCh38) Human (GRCh38)
Location 7:69947086-69947108 7:69947107-69947129
Sequence CCGTACAAAACTGTAAATGCTGG GGGTTTAAAGGGATTGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 187} {0: 1, 1: 0, 2: 2, 3: 28, 4: 2016}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!