ID: 1026450576_1026450586

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1026450576 1026450586
Species Human (GRCh38) Human (GRCh38)
Location 7:70525782-70525804 7:70525828-70525850
Sequence CCCACAGAAGTGAGAGAGGTGGC GAGATGGGCACCTCCAGCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 213} {0: 1, 1: 0, 2: 2, 3: 61, 4: 441}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!