ID: 1026470791_1026470796

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1026470791 1026470796
Species Human (GRCh38) Human (GRCh38)
Location 7:70693248-70693270 7:70693262-70693284
Sequence CCCCACACCCTCTGGGGGCACTG GGGGCACTGCACTGTGCTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 352} {0: 1, 1: 0, 2: 2, 3: 34, 4: 383}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!