ID: 1026473179_1026473181

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1026473179 1026473181
Species Human (GRCh38) Human (GRCh38)
Location 7:70711600-70711622 7:70711613-70711635
Sequence CCTGGTTCATGTCAGAGCAAATC AGAGCAAATCTTTGAACAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 24, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!