ID: 1026531387_1026531391

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1026531387 1026531391
Species Human (GRCh38) Human (GRCh38)
Location 7:71200437-71200459 7:71200455-71200477
Sequence CCAGGTGACTGCATGTCCACTGG ACTGGTGTAAATGGTTTTAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!