ID: 1026534367_1026534369

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1026534367 1026534369
Species Human (GRCh38) Human (GRCh38)
Location 7:71228002-71228024 7:71228022-71228044
Sequence CCGATAGAGGAGGAGACAGTGGC GGCCTGAGAGGACCCCAGTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 221} {0: 1, 1: 0, 2: 0, 3: 13, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!