ID: 1026557011_1026557018

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1026557011 1026557018
Species Human (GRCh38) Human (GRCh38)
Location 7:71417367-71417389 7:71417397-71417419
Sequence CCATCTCGGCCGCCAATTTTCCC TTTTTGCTGTCATCAAACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 78} {0: 1, 1: 0, 2: 0, 3: 19, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!