ID: 1026621032_1026621036

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1026621032 1026621036
Species Human (GRCh38) Human (GRCh38)
Location 7:71950106-71950128 7:71950153-71950175
Sequence CCTTGCTTCATTTGTGCATTTTG AGAACCTGGACACCCTCCCCTGG
Strand - +
Off-target summary No data {0: 2, 1: 96, 2: 106, 3: 121, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!