ID: 1026680540_1026680545

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1026680540 1026680545
Species Human (GRCh38) Human (GRCh38)
Location 7:72463320-72463342 7:72463336-72463358
Sequence CCAGGTACTTTTAGTACAGATGG CAGATGGGGTTTCACCAGGCTGG
Strand - +
Off-target summary No data {0: 2, 1: 84, 2: 2741, 3: 49843, 4: 106900}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!