ID: 1026697640_1026697645

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1026697640 1026697645
Species Human (GRCh38) Human (GRCh38)
Location 7:72609847-72609869 7:72609882-72609904
Sequence CCAGAAAACACATAATTGGAAGG CCTTGTTTTACTTTTTGGATGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 34, 4: 439}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!