ID: 1026704813_1026704821

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1026704813 1026704821
Species Human (GRCh38) Human (GRCh38)
Location 7:72681400-72681422 7:72681450-72681472
Sequence CCTGCTGTCCTGGGTGGTAAAAG TGCCCAATGCAGACTGTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 145} {0: 1, 1: 1, 2: 3, 3: 15, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!