ID: 1026817150_1026817168

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1026817150 1026817168
Species Human (GRCh38) Human (GRCh38)
Location 7:73521970-73521992 7:73522011-73522033
Sequence CCGGCCCCGCGGCGCAGCACTAG AGCGCCAGGCGCCCGGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 141} {0: 1, 1: 0, 2: 1, 3: 16, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!