ID: 1026904144_1026904156

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1026904144 1026904156
Species Human (GRCh38) Human (GRCh38)
Location 7:74053237-74053259 7:74053281-74053303
Sequence CCAGGTGTTGGTGTCCCAGGAGC TGCTGGGATCCCAGGTGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 175} {0: 1, 1: 0, 2: 5, 3: 54, 4: 536}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!