ID: 1026926231_1026926238

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1026926231 1026926238
Species Human (GRCh38) Human (GRCh38)
Location 7:74195860-74195882 7:74195906-74195928
Sequence CCTTGTTTTCACAACTAGGATAA TTCCTATTTAGAGGGAGTCCTGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 1, 3: 15, 4: 244} {0: 2, 1: 0, 2: 1, 3: 10, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!