ID: 1026973079_1026973084

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1026973079 1026973084
Species Human (GRCh38) Human (GRCh38)
Location 7:74479599-74479621 7:74479618-74479640
Sequence CCCTGGGAGGGTCCCGGCAGCTC GCTCAGGTGTCACCTCCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 203} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!