ID: 1026977752_1026977769

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1026977752 1026977769
Species Human (GRCh38) Human (GRCh38)
Location 7:74508756-74508778 7:74508809-74508831
Sequence CCTTCACCCCTCTTGCCATTCCC TCTCCTAGCAGGTGACCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 528} {0: 1, 1: 0, 2: 1, 3: 20, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!