ID: 1027017382_1027017394

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1027017382 1027017394
Species Human (GRCh38) Human (GRCh38)
Location 7:74788020-74788042 7:74788067-74788089
Sequence CCTGCAAAAGTCAGGGCAAGACG AGCGGGGGGCGCCGCCCCGCAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 0, 3: 8, 4: 98} {0: 3, 1: 0, 2: 1, 3: 21, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!