ID: 1027108168_1027108181

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1027108168 1027108181
Species Human (GRCh38) Human (GRCh38)
Location 7:75418587-75418609 7:75418622-75418644
Sequence CCCTCCGCATCCTGCTTCCCCTT TGCTTCCTCCAGAAGGGAAAGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 41, 4: 573} {0: 3, 1: 0, 2: 4, 3: 30, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!