ID: 1027111548_1027111560

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1027111548 1027111560
Species Human (GRCh38) Human (GRCh38)
Location 7:75443679-75443701 7:75443722-75443744
Sequence CCTGTATTCCCAGCACTTCGAAG TGAGGTCAGGAGTTCAAGACCGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 176, 3: 4436, 4: 38511} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!