ID: 1027126412_1027126420

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1027126412 1027126420
Species Human (GRCh38) Human (GRCh38)
Location 7:75559711-75559733 7:75559726-75559748
Sequence CCGCCCCCACCCACCGCTCACTT GCTCACTTTCTATCTCAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 69, 4: 883} {0: 1, 1: 0, 2: 0, 3: 11, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!