ID: 1027171831_1027171837

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1027171831 1027171837
Species Human (GRCh38) Human (GRCh38)
Location 7:75878334-75878356 7:75878355-75878377
Sequence CCCAAGGAGTTCCGGGCTGGGAT ATTTTAAAGGGCATTGTGAAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 11, 3: 37, 4: 160} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!