ID: 1027350862_1027350874

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1027350862 1027350874
Species Human (GRCh38) Human (GRCh38)
Location 7:77309498-77309520 7:77309535-77309557
Sequence CCCATGATATGGCTGCATGACTG TGGTGTTTCTGGAGGGAAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 192} {0: 1, 1: 0, 2: 7, 3: 69, 4: 497}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!