ID: 1027381512_1027381513

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1027381512 1027381513
Species Human (GRCh38) Human (GRCh38)
Location 7:77614896-77614918 7:77614917-77614939
Sequence CCAGTATTATTTCTGTAGAAATT TTTTAGTTTGATATACTAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 480} {0: 1, 1: 0, 2: 0, 3: 19, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!