ID: 1027406972_1027406978

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1027406972 1027406978
Species Human (GRCh38) Human (GRCh38)
Location 7:77872363-77872385 7:77872383-77872405
Sequence CCATCCACATACCTCTTCCCCAG CAGATTTGTATAAACTAAGTAGG
Strand - +
Off-target summary {0: 21, 1: 125, 2: 197, 3: 181, 4: 590} {0: 1, 1: 0, 2: 0, 3: 15, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!