ID: 1027468816_1027468824

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1027468816 1027468824
Species Human (GRCh38) Human (GRCh38)
Location 7:78548383-78548405 7:78548436-78548458
Sequence CCTCCATGTATTTTAAGATTGCT CTGTAATCCCAGCACTTTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 218} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!