ID: 1027506015_1027506020

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1027506015 1027506020
Species Human (GRCh38) Human (GRCh38)
Location 7:79017560-79017582 7:79017606-79017628
Sequence CCCAGCAACAGTTCCTAACTAGG ATAAAATTCAGAATATAGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 570} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!