ID: 1027515443_1027515448

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1027515443 1027515448
Species Human (GRCh38) Human (GRCh38)
Location 7:79136907-79136929 7:79136921-79136943
Sequence CCTGATAGCTCCCTGATGCCTCC GATGCCTCCCATTGGTCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 240} {0: 1, 1: 0, 2: 0, 3: 12, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!