ID: 1027520374_1027520379

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1027520374 1027520379
Species Human (GRCh38) Human (GRCh38)
Location 7:79199222-79199244 7:79199251-79199273
Sequence CCAACAAGAGTAATAATATTAAT GGCTGCATTTGGAGGGCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 66, 4: 741} {0: 1, 1: 0, 2: 5, 3: 32, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!