ID: 1027524111_1027524114

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1027524111 1027524114
Species Human (GRCh38) Human (GRCh38)
Location 7:79245464-79245486 7:79245490-79245512
Sequence CCTTGAATGAACATTGGCAGTAG GGCAGTACTCTCTACAAGTTCGG
Strand - +
Off-target summary {0: 4, 1: 27, 2: 161, 3: 361, 4: 715} {0: 1, 1: 0, 2: 0, 3: 7, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!