ID: 1027758494_1027758496

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1027758494 1027758496
Species Human (GRCh38) Human (GRCh38)
Location 7:82247574-82247596 7:82247611-82247633
Sequence CCAAAGTAAATCCAAGCATGCAT GTGCTTTATCATGAAAACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 180} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!