ID: 1027856984_1027856987

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1027856984 1027856987
Species Human (GRCh38) Human (GRCh38)
Location 7:83524286-83524308 7:83524339-83524361
Sequence CCAGTCTTCTTCAGCAGATAAAT AAACCTGTCTTTACAAGCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 52, 4: 494} {0: 1, 1: 0, 2: 0, 3: 17, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!