ID: 1027963020_1027963023

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1027963020 1027963023
Species Human (GRCh38) Human (GRCh38)
Location 7:84970753-84970775 7:84970787-84970809
Sequence CCAGGAAATATATTGTATAATTT AAGGAACTATTGAAATCTTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!