ID: 1028035082_1028035086

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1028035082 1028035086
Species Human (GRCh38) Human (GRCh38)
Location 7:85972150-85972172 7:85972200-85972222
Sequence CCAATGGAGGGTTAGCAAGGTGG GCTCTGAGAAGACCTGAAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 44, 3: 159, 4: 472}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!