ID: 1028208226_1028208242

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1028208226 1028208242
Species Human (GRCh38) Human (GRCh38)
Location 7:88041183-88041205 7:88041231-88041253
Sequence CCATCGTATTTACAGTCCCACCA GGGGGTATACACCTTGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 110} {0: 1, 1: 0, 2: 0, 3: 6, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!