ID: 1028298665_1028298674

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1028298665 1028298674
Species Human (GRCh38) Human (GRCh38)
Location 7:89169134-89169156 7:89169161-89169183
Sequence CCTGCCCCATCCGGAGGAGTGAA AATGGCAGGTCTGTGATGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 24, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!