ID: 1028303229_1028303236

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1028303229 1028303236
Species Human (GRCh38) Human (GRCh38)
Location 7:89228715-89228737 7:89228761-89228783
Sequence CCCACACCGGGGTGCAGGTGGAG CGCCCACACTCCTCAGCCCTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 18, 3: 50, 4: 246} {0: 85, 1: 384, 2: 658, 3: 675, 4: 627}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!