ID: 1028855884_1028855889

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1028855884 1028855889
Species Human (GRCh38) Human (GRCh38)
Location 7:95593421-95593443 7:95593454-95593476
Sequence CCTCCTACACATCTCATTATTGG TAGTAAAAATAGGTCTCCCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!