ID: 1028855884_1028855891

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1028855884 1028855891
Species Human (GRCh38) Human (GRCh38)
Location 7:95593421-95593443 7:95593456-95593478
Sequence CCTCCTACACATCTCATTATTGG GTAAAAATAGGTCTCCCTGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!